check the uploaded file carefully it have all of the instructions

Unknown sequence for SLE111 Bioinformatics Assignment 2012. TTCAGCTAGGAAAAGAGTCAACCCAAGGATTGGGTTGCGGTGCAAACCCAGAATCAGGGCGTCGAGCCGCGGAAGAAAGTAAAGAGGAAATTGCCAGATATATTGCAGATGCTAATATGGTATTTATAACTGCCGGTATGGGTGGTGGAACAGGAACAGGGGCCGCGCCTGTAGTAGCCGAGGTTTGCATGGAAAAGGACATTCTAACGGTGGCAGTGGTCACTAAACCATTTAGCTTTGAGGGGAAGCATCGCGCTCGCCTAGCAAACGAAGGAATAAGGTCTCTCGAAGATCGTGTTGACACGCTAATAATAATTCCAAATCAAAATATATTCAAGCTCATTAACGCGTCGACGTCAATGGCCGATGCGTTCGGCCTGGCTGACGACATTTTGTTGGCCGGCGTGAAGAGCATCACGGACCTGATGGTTCGGCCGGGACTGATCAACTTGGACTTCGCAGATGTCCGCACGGTGATGAGCGGGATGGGCCACGCCATCATGGGCACAGGGCAGGCGGAAGGCGAGGATAGAGCGATTCGCGCCGCCAACGACGCGCTGAACAACCCTCT Unknown sequence for SLE111 Bioinformatics Assignment 2012. TTCAGCTAGGAAAAGAGTCAACCCAAGGATTGGGTTGCGGTGCAAACCCAGAATCAGGGCGTCGAGCCGCGGAAGAAAGTAAAGAGGAAATTGCCAGATATATTGCAGATGCTAATATGGTATTTATAACTGCCGGTATGGGTGGTGGAACAGGAACAGGGGCCGCGCCTGTAGTAGCCGAGGTTTGCATGGAAAAGGACATTCTAACGGTGGCAGTGGTCACTAAACCATTTAGCTTTGAGGGGAAGCATCGCGCTCGCCTAGCAAACGAAGGAATAAGGTCTCTCGAAGATCGTGTTGACACGCTAATAATAATTCCAAATCAAAATATATTCAAGCTCATTAACGCGTCGACGTCAATGGCCGATGCGTTCGGCCTGGCTGACGACATTTTGTTGGCCGGCGTGAAGAGCATCACGGACCTGATGGTTCGGCCGGGACTGATCAACTTGGACTTCGCAGATGTCCGCACGGTGATGAGCGGGATGGGCCACGCCATCATGGGCACAGGGCAGGCGGAAGGCGAGGATAGAGCGATTCGCGCCGCCAACGACGCGCTGAACAACCCTCT