Microbiology/biology problem set

Microbiology/biology problem set

Microbiology/biology problem set

This is an unformatted preview. Please download the attached document for the original format.
Problem Set 4

1. Short regions of DNA sequence from four different organisms are shown below.
Organism
Organism
Organism
Organism

A
B
C
D

AGGTAAGTTACATTTGCAAGCTCTATTGACGCCC
AGGTAAGTTAGATTTGCAGGTCCTATTGACGCCC
AGGTAAGTTAGATTCGCAGGTCCTATTGACGCCC
AGCTAAGTTAGATTTGCAGGTCCTATTGACGCCC

Here are the same sequences aligned below for you to highlight their differences in sequence:

A) Strictly on the basis of these sequences (i.e. – extent of homology) briefly describe the
phylogenetic relationship of these three organisms (i.e - which are the more closely or
distantly related)

B) Draw a rooted tree that illustrates your conclusions. (Use Fig. 17.17 in your text and the
Phylogenetic Trees animation in the chapter 17 section of iLearn as guides for how to
proceed with this part.)

C) Assume that the sequences above were obtained from 16s rRNA genes and that the percent
sequence similarity you determined for these short sequences is the same as that for the
entire 16s rRNA coding regions. Additionally, assume that: 1) further analysis reveals that
several orthologous genes have the same percent similarity that you saw in the SSU analysis
and 2) total genomic DNA hybridization analysis reveals the percent similarity shown in the
table below. Using the working definition of a species described in section 17.5 of the class
textbook (3rd edition) and the guidelines in Figure 1 below, complete the table below.
NOTE: the guidelines in the textbook are more up-to-date and take more factors into
consideration than the guidelines in Figure 1, which are based solely on DNA hybridization

Problem Set 4

data. Therefore, the guidelines in section 17.5 should take preference in cases where the
two methods lead to alternative results.

Organisms A and D

% similarity
(DNA hybridization)
20

Organisms C and D

79

Organisms B and D

Same genus?

Same species?

71

D) Based on the data in part C above:
i) Which pair of organisms would you expect to have the highest degree of nucleotide
similarity in their informational genes (as discussed in section 17.3)?

ii) Which pair has the highest degree of nucleotide similarity in their operational genes?

2. The purple phototrophic bacteria and the cyanobacteria can both generate energy by
photosynthesis but differ physiologically and ecologically in the way they do it. Which of
these two photosynthetic organisms has remained more metabolically and ecologically similar
to their last common ancestor? Explain the reasoning behind your answer. (4 points)

Problem Set 4

3. Eukaryotic cells are generally more highly compartmentalized than prokaryotic cells. In
addition to the nucleus, eukaryotes contain a number of subcellular membrane-enclosed
organelles in the cytoplasm including, the endoplasmic reticulum, the Golgi, endosomes,
hydrogenosomes, lysosomes, mitochondria, peroxisomes and, in photosynthetic organisms,
chloroplasts. Additionally, eukaryotic cells also contain transport vesicles that move cargo
among particular organelles and secretory vesicles that deliver cargo to the cytoplasmic
membrane.
For each of the proteins below, list all of the subcellular organelles (indicated in bold type
above) involved in its expression and targeting. For example, for the expression of a
cytoplasmic protein, the mRNA for the gene encoding it is transcribed in the nucleus and
transported to the cytoplasm where the protein is translated and released, so an appropriate
answer would be: nucleus and cytoplasm. The material in your textbook’s appendix A2.4
should be helpful in answering these following questions.
A.
B.
C.
D.

a protein that is secreted from the cell
a lysosomal protein
a nuclear protein
the envelope glycoprotein (env) of HIV-1

In which compartments do the following processes occur?
E. oxidative phosphorylation
F. hydrolysis of macromolecules (such as proteins, fats and carbohydrates) that are taken up
from the extracellular space by endocytosis or phagocytosis
G. photosynthesis
H. oxidation of pyruvate
I. transcription
J. glycosylation of proteins
K. sorting of proteins to appropriate organelles such as lysosomes