Microbiology Problem set

Microbiology Problem set

Subject: Biology    / General Biology
Question

Problem Set 4

Save your time!

  • Proper editing and formatting
  • Free revision, title page, and bibliography
  • Flexible prices and money-back guarantee

1. Short regions of DNA sequence from four different organisms are shown below.
Organism
Organism
Organism
Organism

A
B
C
D

AGGTAAGTTACATTTGCAAGCTCTATTGACGCCC
AGGTAAGTTAGATTTGCAGGTCCTATTGACGCCC
AGGTAAGTTAGATTCGCAGGTCCTATTGACGCCC
AGCTAAGTTAGATTTGCAGGTCCTATTGACGCCC

Make sure you submit a unique essay

Our writers will provide you with an essay sample written from scratch: any topic, any deadline, any instructions.

100% ORIGINAL

Here are the same sequences aligned below for you to highlight their differences in sequence:

A) Strictly on the basis of these sequences (i.e. – extent of homology) briefly describe thephylogenetic relationship of these three organisms (i.e – which are the more closely ordistantly related)

B) Draw a rooted tree that illustrates your conclusions. (Use Fig. 17.17 in your text and thePhylogenetic Trees animation in the chapter 17 section of iLearn as guides for how toproceed with this part.)

C) Assume that the sequences above were obtained from 16s rRNA genes and that the percentsequence similarity you determined for these short sequences is the same as that for theentire 16s rRNA coding regions. Additionally, assume that: 1) further analysis reveals thatseveral orthologous genes have the same percent similarity that you saw in the SSU analysisand 2) total genomic DNA hybridization analysis reveals the percent similarity shown in thetable below. Using the working definition of a species described in section 17.5 of the class
textbook (3rd edition) and the guidelines in Figure 1 below, complete the table below.NOTE: the guidelines in the textbook are more up-to-date and take more factors intoconsideration than the guidelines in Figure 1, which are based solely on DNA hybridizationdata. Therefore, the guidelines in section 17.5 should take preference in cases where thetwo methods lead to alternative results.

Organisms A and D

% similarity
(DNA hybridization)
20

Organisms C and D

79

Organisms B and D

Same genus?

Same species?

71

D) Based on the data in part C above:
i) Which pair of organisms would you expect to have the highest degree of nucleotidesimilarity in their informational genes (as discussed in section 17.3)?

ii) Which pair has the highest degree of nucleotide similarity in their operational genes?

2. The purple phototrophic bacteria and the cyanobacteria can both generate energy byphotosynthesis but differ physiologically and ecologically in the way they do it. Which ofthese two photosynthetic organisms has remained more metabolically and ecologically similarto their last common ancestor? Explain the reasoning behind your answer. (4 points)

Problem Set 4

3. Eukaryotic cells are generally more highly compartmentalized than prokaryotic cells. Inaddition to the nucleus, eukaryotes contain a number of subcellular membrane-enclosedorganelles in the cytoplasm including, the endoplasmic reticulum, the Golgi, endosomes,hydrogenosomes, lysosomes, mitochondria, peroxisomes and, in photosynthetic organisms,chloroplasts. Additionally, eukaryotic cells also contain transport vesicles that move cargoamong particular organelles and secretory vesicles that deliver cargo to the cytoplasmicmembrane.
For each of the proteins below, list all of the subcellular organelles (indicated in bold typeabove) involved in its expression and targeting. For example, for the expression of acytoplasmic protein, the mRNA for the gene encoding it is transcribed in the nucleus andtransported to the cytoplasm where the protein is translated and released, so an appropriateanswer would be: nucleus and cytoplasm. The material in your textbook’s appendix A2.4should be helpful in answering these following questions.
A.
B.
C.
D.

a protein that is secreted from the cell
a lysosomal protein
a nuclear protein
the envelope glycoprotein (env) of HIV-1

In which compartments do the following processes occur?
E. oxidative phosphorylation
F. hydrolysis of macromolecules (such as proteins, fats and carbohydrates) that are taken upfrom the extracellular space by endocytosis or phagocytosis
G. photosynthesis
H. oxidation of pyruvate
I. transcription
J. glycosylation of proteins
K. sorting of proteins to appropriate organelles such as lysosomes

https://applewriters.com/place-order/
Order Now