coding strand,mRNA, polypeptide sequence specified by the bacterial

coding strand,mRNA, polypeptide sequence specified by the bacterial

Category: Biology
Question description

Using the genetic code table (Chapter 10 Translation, page 142 or https://en.wikipedia.org/wiki/Genetic_code#/media/File:Notable_mutations.svg), give

1) coding strand,

2) mRNA,

3) polypeptide sequence specified by the bacterial mRNA sequences

and indicate 5’ ends, 3’ ends, the amino and carboxyl ends of the polypeptide produced.(assume only one reading frame starting from the first nucleotide)

3’ TACAAATTTAAATTTAAAACT 5’ template strand